Javascript is currently disabled in your browser.Some features of this website will not work when javascript is disabled.
Register with your specific details and specific drug of interest and we will match the information you provide with articles in our extensive database and email a PDF copy to you immediately.
Ban-Lan-Gen granules attenuate dextran sodium sulfate-induced chronic relapsing colitis in mice by modulating gut microbiota and restoring intestinal SCFA Derived-GLP-1 production
Jiao Peng,1-3,*Li Xi,4,*Zheng Lin,3,5 Duan Lifang,1 Gao Zhengxian,2,5 Diehu,1 Li Jie,6 Li Xiaofeng,6 Shen Xiangchun,5 Xiao Haitao21Peking University Shenzhen Hospital Department of Pharmacy, Shenzhen, People’s Republic of China; 2Shenzhen University Health Science Center School of Pharmacy, Shenzhen, People’s Republic of China; 3Guizhou Medical University Engineering Technology Research Center of Ethnic Medicine and Traditional Chinese Medicine Development and Application Ministry of Education, Guizhou Provincial Key Laboratory of Pharmacy, Guizhou Medical University , Guiyang, People’s Republic of China; 4 Department of Gastroenterology, Peking University Shenzhen Hospital, Shenzhen, People’s Republic of China; 5 School of Pharmacy, Guizhou Medical University, State Key Laboratory of Medicinal Plant Function and Application, Guiyang; 6 Department of Laboratory Medicine, Peking University Shenzhen Hospital, Shenzhen, China [email protected] Shen Xiangchun, School of Pharmacy, Guizhou Medical University, Guizhou, People’s Republic of China, 550004, Email [email protected] Objective: GLP-1-based therapy is a new treatment option for inflammatory bowel disease.Ban-Lan-Gen (BLG) granules are a known antiviral TCM formulation that exhibits potential anti-inflammatory activity in the treatment of various inflammatory conditions.However, its anti-inflammatory effect on colitis and its mechanism of action are still unclear.METHODS: To establish dextran sodium sulfate (DSS)-induced chronic relapsing colitis in mice.Disease activity indices, histological markers of injury, and proinflammatory cytokine levels were performed to assess the protective effect of BLG.The effects of BLG on the gut microbiota and gut were characterized by serum GLP-1 levels and colonic Gcg, GPR41, and GRP43 expression, gut microbiota composition, fecal SCFAs levels, and GLP-1 release from primary mouse colonic epithelial cells SCFA-derived GLP-1 production.Results: BLG treatment significantly reduced body weight loss, DAI, colon shortening, colon tissue damage, and proinflammatory cytokine levels of TNF-α, IL-1β, and IL-6 in colon tissue.In addition, BLG treatment can significantly restore colonic Gcg, GPR41 and GRP43 expression and serum GLP-1 levels in colitis mice, and by increasing SCFA-producing bacteria such as Akkermansia and Prevotellaceae_UCG-001, and reducing the abundance of bacteria such as Eubacterium_xylanophilum_group, Ruminococcaceae_UCG-014, Intestinimonas and Oscillibacter. In addition, BLG treatment can significantly increase the level of SCFAs in the feces of colitis mice. At the same time, in vitro experiments also showed that the fecal extract of BLG-treated mice can greatly stimulate the primary small Murine colonic epithelial cells secrete GLP-1. Conclusions: These findings suggest that BLG has an anti-colitis effect. BLG has the potential to be developed as a therapy, at least in part by modulating gut microbiota and restoring intestinal SCFA-derived GLP-1 production Promising drugs for chronic relapsing colitis. Keywords: colitis, Ban-Lan-Gen granules, gut microbiota, short-chain fatty acids, GLP-1
Ulcerative colitis (UC) is a long-term inflammatory disease of the colon and rectum characterized by recurrent diarrhea, abdominal pain, weight loss, and mucopurulent bloody stools.1 Recently, the prevalence of UC has been increasing in previously low-incidence countries, including China, with the increasing popularity of Western lifestyles.2 This increase poses major problems for public health and has serious implications for patients’ ability to work and quality of life.Notably, the pathogenesis of UC remains largely unclear, but it is generally accepted that genetics, environmental factors, the gut microbiota, and the immune system all contribute to the development of UC.3 Even now, there is no cure for UC, and the goal of treatment is clinically to control clinical symptoms, induce and maintain remission, promote mucosal healing, and reduce recurrence.Classical treatments include aminosalicylates​​​​, corticosteroids, immunosuppressants, and biologics.However, these drugs cannot achieve the desired effect due to their various side effects.4 Recently, many case studies have shown that traditional Chinese medicine (TCM) has shown great potential in helping to relieve UC with low toxicity, suggesting that the development of new TCM therapies is a promising treatment strategy for UC.5-7​​​
Banlangen Granules (BLG) is a traditional Chinese medicine preparation made from the water extract of Banlangen root.8 In addition to its antiviral efficacy, BLG exhibits potential anti-inflammatory activity in the treatment of various inflammatory conditions.9,10 In addition, glucosinolates (R,S-goitrin, progoitrin, epiprorubin and glucoside have been isolated and identified from aqueous extracts of Radix isatidis) and nucleosides (hypoxanthine, adenosine, uridine and guanosine) and indigo alkaloids such as indigo and indirubin.11,12 Previous studies have well documented that the compounds adenosine, uridine and indirubin exhibit potent anti-colitis effects in different animal models of colitis.13-17 However, no evidence-based studies have been conducted to evaluate the efficacy of BLG in colitis.In the present study, we investigated the protective effect of BLG on dextran sodium sulfate (DSS)-induced chronic relapsing colitis in C57BL/6 mice and found that oral administration of BLG significantly attenuated DSS-induced chronic relapsing colon in mice Inflammation, its regulatory mechanisms are associated with modulation of gut microbiota and restoration of gut-derived glucagon-like peptide-1 (GLP-1) production.
BLG granules (sugar-free, NMPA-approved Z11020357; Beijing Tongrentang Technology Development Co., Ltd., Beijing, China; batch number: 20110966) were purchased from pharmacies.DSS (Molecular Weight: 36,000–50,000 Daltons) was purchased from MP Biologicals (Santa Ana, USA).Sulfasalazine (SASP) (≥ 98% purity), hematoxylin and eosin were purchased from Sigma-Aldrich (St. Louis, MO, USA).Mouse TNF-α, IL-1β and IL-6 luminex Elisa assay kits were purchased from R&D systems (Minneapolis, MN, USA).Acetic acid, propionic acid, and butyric acid were purchased from Aladdin Industries (Shanghai, China).2-Ethylbutyric acid was purchased from Merck KGaA (Darmstadt, Germany).
6-8-week-old male C57BL/6 mice (body weight 18-22 g) were purchased from Beijing Wetahe Laboratory Animal Technology Co., Ltd. (Beijing, China) and housed in an environment of 22 ± 2 °C with 12 h light/ dark cycle.Mice were fed a standard rodent diet with free access to drinking water for one week to acclimate to the new environment.The mice were then randomly divided into four groups: control group, DSS model group, SASP-treated group (200 mg/kg, oral) and BLG-treated group (1 g/kg, oral).As shown in Figure 1A, according to our previous study, experimental chronic relapsing colitis was induced in mice by three cycles of 1.8% DSS for 5 days, followed by distilled water for 7 days, according to our previous study.18 Mice in the SASP and BLG treated groups were treated with SASP and BLG, respectively, every day starting from day 0.According to preliminary experiments, the dose of BLG was set at 1 g/kg.Meanwhile, the dose of SASP was set at 200 mg/Kg according to the literature.4 The control and DSS model groups received the same volume of water throughout the experiment.
Figure 1 BLG ameliorates DSS-induced chronic relapsing colitis in mice.(A) Experimental design of chronic recurrent colitis and treatment, (B) body weight change, (C) disease activity index (DAI) score, (D) colon length, (E) representative image of colon, (F) H&E staining Colon (magnification, ×100) and (G) histological score.Data are presented as mean ± SEM (n = 6).##p < 0.01 or ###p < 0.001 vs control (Con) group; *p < 0.05 or **p < 0.01 or ***p < 0.001 vs DSS group.
Body weight, stool consistency, and rectal bleeding were recorded daily.Disease activity index (DAI) was determined by combining scores of body weight, stool consistency, and rectal bleeding as described previously.19 At the end of the experiment, all mice were euthanized and blood, feces and colon were collected for further experiments.
Colon tissue was formalin-fixed and embedded in paraffin.5-micron sections were made and stained with hematoxylin-eosin (H&E), then blinded and scored as previously described.19
Total RNA of colon tissue was extracted by Trizol reagent (Invitrogen, Carlsbad, CA), followed by cDNA extraction with reverse transcriptase (TaKaRa, Kusatsu, Shiga, Japan).Quantitative PCR was performed using a real-time PCR system with SYBR Green Master (Roche, Basel, Switzerland).Target gene transcripts were normalized to β-actin and data were analyzed using the 2-ΔΔCT method.The gene primer sequences are shown in Table 1.
Primary mouse colonic epithelial cell isolation and culture were performed as previously described.20 Briefly, colons of 6-8 week old mice were first excised after sacrifice by cervical dislocation, then longitudinally opened, treated with Hanks Balanced Salt Solution (HBSS, without calcium and magnesium) and cut into 0.5-1 mm of small pieces.Subsequently, tissues were digested with 0.4 mg/mL collagenase XI (Sigma, Poole, UK) in free DMEM medium and centrifuged at 300 x g for 5 min at room temperature.Resuspend the pellet in DMEM medium (supplemented with 10% fetal bovine serum, 100 Units/mL penicillin, and 100 µg/mL streptomycin) at 37 °C and pass through a nylon mesh (pore size ~250 µm).Aliquots of colonic epithelial cells were placed in glass-bottom dishes and incubated with acetic acid, propionic acid, butyric acid, and mouse fecal extracts for 2 hours at 37°C, 5% CO2.
Colon tissue was homogenized with PBS, and the levels of cytokines IL-6, TNF-α and IL-1β in colon tissue were detected using luminex ELISA assay kits (R&D systems, Minneapolis, MN, USA).Likewise, GLP-1 levels in serum and culture medium of primary murine colonic epithelial cells were determined with an ELISA kit (Bioswamp, Wuhan, China) according to the manufacturer’s instructions.
Total DNA from feces was extracted using a DNA extraction kit (Tiangen, China).The quality and quantity of DNA were measured at the ratios of 260 nm/280 nm and 260 nm/230 nm, respectively.Subsequently, using each extracted DNA as a template, specific primers 338F (ACTCCTACGGGAGGCAGCAG) and 806R (GGACTACHVGGGTWTCTAAT) were used to amplify the V3-V4 regions of the 16S rRNA gene in different regions.PCR products were purified using the QIAquick Gel Extraction Kit (QIAGEN, Germany), quantified by real-time PCR, and sequenced using the IlluminaMiseq PE300 sequencing platform (Illumina Inc., CA, USA).For bioinformatics analysis, data processing was performed following previously reported protocols.21,22 In short, use Cutadapt (V1.9.1) to filter raw express files.OTUs were clustered using UPARSE (version 7.0.1001) with a similarity cutoff of 97%, and UCHIME was used to remove chimeric sequences.Community composition analysis and classification were performed using the RDP classifier (http://rdp.cme.msu.edu/) based on the SILVA ribosomal RNA gene database.
Levels of short-chain fatty acids (acetic acid, propionic acid, and butyric acid) were measured as previously described by Tao et al., with some modifications.23 Briefly, 100 mg of feces were first suspended in 0.4 mL of deionized water, followed by 0.1 mL of 50% sulfuric acid and 0.5 mL of 2-ethylbutyric acid (internal standard), then homogenized and heated at 4°C. Centrifuge at 12,000 rpm for 15 minutes at C.The supernatant was extracted with 0.5 mL of ether and injected into the GC for analysis.For gas chromatography (GC) analysis, samples were analyzed using a GC-2010 Plus gas chromatograph (Shimadzu, Inc.) equipped with a flame ionization detector (FID).Separation was achieved using a ZKAT-624 column, 30 m × 0.53 mm × 0.3 μm (Lanzhou Zhongke Antai Analytical Technology Co., Ltd., China).Data were acquired using GC solution software (Shimadzu, Inc.).The split ratio was 10:1, the carrier gas was nitrogen, and the flow rate was 6 mL/min.The injection volume was 1 μL.The injector and detector temperature was 300°C.The oven temperature was held at 140°C for 13.5 minutes, then increased to 250°C at a rate of 120°C/min; the temperature was held for 5 minutes.
Data are presented as mean ± standard error of the mean (SEM).Data significance was assessed by one-way ANOVA followed by Duncan’s multiple range test.GraphPad Prism 5.0 software (GraphPad Software Inc., San Diego, CA, USA) was used for all calculations and p < 0.05 was considered statistically significant.
It is well known that UC is a chronic relapsing colitis disease with severe abdominal pain, diarrhea and bleeding.Therefore, DSS-induced chronic relapsing colitis in mice was established to evaluate the anti-colitis efficacy of BLG (Fig. 1A).Compared with the control group, mice in the DSS model group had significantly reduced body weight and higher DAI, and these changes were significantly reversed after 24 days of BLG treatment (Figure 1B and C).Colon shortening is an important hallmark of UC.As shown in Figures 1D and E, the colon lengths of mice that received DSS were significantly shortened, but were relieved by BLG treatment.Subsequently, histopathological analysis was performed to assess colonic inflammation.H&E stained images and pathological scores showed that DSS administration significantly disrupted colonic architecture and resulted in crypt destruction, whereas BLG treatment significantly reduced crypt destruction and pathological scores (Figure 1F and G).Notably, the protective effect of BLG at a dose of 1 g/Kg was comparable to that of SASP at a dose of 200 mg/Kg.Collectively, these findings suggest that BLG is effective in reducing the severity of DSS-induced chronic relapsing colitis in mice.
TNF-α, IL-1β and IL-6 are important inflammatory markers of colonic inflammation.As shown in Figure 2A, DSS induced a significant increase in the gene expression of TNF-α, IL-1β and IL-6 in the colon compared with the control group.Administration of BLG can significantly reverse these DSS-mediated changes.Next, we used ELISA to determine the levels of the inflammatory cytokines TNF-α, IL-1β, and IL-6 in colon tissue.The results also showed that colonic levels of TNF-α, IL-1β, and IL-6 were significantly increased in mice treated with DSS, whereas BLG treatment alleviated these increases (Figure 2B).
Figure 2 BLG inhibits gene expression and production of the proinflammatory cytokines TNF-α, IL-1β and IL-6 in the colon of DSS-treated mice.(A) Colonic gene expression of TNF-α, IL-1β and IL-6; (B) colonic protein levels of TNF-α, IL-1β and IL-6.Data are presented as mean ± SEM (n = 4–6).#p < 0.05 or ##p < 0.01 or ###p < 0.001 vs control (Con) group; *p < 0.05 or **p < 0.01 vs DSS group.
Intestinal dysbiosis is critical in the pathogenesis of UC.24 To investigate whether BLG modulates the gut microbiota of DSS-treated mice, 16S rRNA sequencing was performed to analyze the bacterial community of gut contents.The Venn diagram shows that the three groups share 385 OTUs.At the same time, each group had unique OTUs (Fig. 3A).Furthermore, the Chao1 index and Shannon index shown in Figure 3B and C showed that the community diversity of the gut microbiota was reduced in BLG-treated mice, as the Shannon index was significantly decreased in the BLG-treated group.Principal component analysis (PCA) and principal coordinate analysis (PCoA) were used to determine clustering patterns among the three groups and showed that the community structure of DSS-treated mice was clearly separated after BLG treatment (Figure 3D and E).These data suggest that BLG treatment significantly affected the community structure of mice with DSS-induced colitis.
Figure 3 BLG alters the diversity of gut microbiota in mice with DSS-induced colitis.(A) Venn diagram of OTU, (B) Chao1 index, (C) Shannon’s richness index, (D) Principal Component Analysis (PCA) score plot of OTU, (E) OTU Principal Coordinate Analysis (PCoA) score Figure. Data are presented as mean ± SEM (n = 6).**p < 0.01 vs DSS group.
To assess specific changes in the fecal microbiota, we analyzed the composition of the gut microbiota at all taxonomic levels.As shown in Figure 4A, the main phyla in all groups were Firmicutes and Bacteroidetes, followed by Verrucomicrobia.The relative abundances of Firmicutes and Firmicutes/Bacteroidetes ratios were significantly increased in the fecal microbial communities of DSS-treated mice compared with control mice, and these changes were significantly reversed after BLG treatment .In particular, BLG treatment significantly increased the relative abundance of Verrucobacterium in the feces of mice with DSS-induced colitis.At the household level, fecal microbial communities were occupied by Lachnospiriaceae, Muribaculaceae, Akkermansiaceae, Ruminococcaceae and Prevotellaceae (Fig. 4B).Compared with the DSS group, depletion of BLG increased the abundance of Akkermansiaceae, but decreased the abundance of Lachnospiraceae and Ruminococcaceae.Notably, at the genus level, the fecal microbiota was occupied by Lachnospira_NK4A136_group, Akkermansia and Prevotellaceae_UCG-001 (Fig. 4C).This finding also demonstrated that BLG treatment effectively reversed the microbiota imbalance in response to DSS challenge, characterized by a decrease in Eubacterium_xylanophilum_group, Ruminococcaceae_UCG-014, Intestinimonas and Oscillibacter, and an increase in Akkermansia and Prevotellaceae_UCG-001.
Figure 4 BLG alters gut microbiota abundance in DSS-induced colitis mice.(A) Abundance of gut microbiota at the phylum level; (B) Abundance of gut microbiota at the family level; (C) Abundance of gut microbiota at the genus level.Data are presented as mean ± SEM (n = 6).#p < 0.05 or ###p < 0.001 vs control (Con) group; *p < 0.05 or **p < 0.01 or ***p < 0.001 vs DSS group.
Considering that short-chain fatty acids (SCFAs) are the major metabolites of Akkermansia and Prevotellaceae_UCG-001, while acetate, propionate and butyrate are the most abundant SCFAs in the intestinal lumen, 25-27 we are still in our study.As shown in Figure 5, fecal acetate, propionate, and butyrate concentrations were significantly reduced in the DSS-treated group, while BLG treatment could largely suppress this reduction.
Figure 5. BLG increases the levels of SCFAs in the feces of mice with DSS-induced colitis.(A) Acetic acid content in feces; (B) propionic acid content in feces; (C) butyric acid content in feces.Data are presented as mean ± SEM (n = 6).#p < 0.05 or ##p < 0.01 vs control (Con) group; *p < 0.05 or **p < 0.01 vs DSS group.
We further calculated the Pearson correlation coefficient between genus-level differential SCFA and fecal microbiota.As shown in Figure 6, Akkermansia was positively correlated with the production of propionic acid (Pearson = 0.4866) and butyric acid (Pearson = 0.6192).In contrast, both Enteromonas and Oscillobacter were negatively associated with acetate production, with Pearson coefficients of 0.4709 and 0.5104, respectively.Likewise, Ruminococcaceae_UCG-014 was negatively correlated with the production of propionic acid (Pearson = 0.4508) and butyric acid (Pearson = 0.5842), respectively.
Figure 6 Pearson correlation analysis between differential SCFAs and colonic microbes.(A) Enteromonas with acetic acid; (B) Concussion bacillus with acetic acid; (C) Akkermansia vs propionic acid; (D) Ruminococcus_UCG-014 with propionic acid; (E) Akkermansia with butyric acid; (F) ) Ruminococcus _UCG-014 with butyric acid.
Glucagon-like peptide-1 (GLP-1) is a cell-type-specific post-translational product of proglucagon (Gcg) with anti-inflammatory properties.28 As shown in Figure 7, DSS induced a significant decrease in Gcg mRNA expression.Colon and BLG treatment could significantly reverse the DSS-induced Gcg reduction compared with the control group (Fig. 7A).At the same time, the level of GLP-1 in serum was significantly reduced in the DSS-treated group, and BLG treatment could largely prevent this reduction (Fig. 7B).Since short-chain fatty acids can stimulate GLP-1 secretion through G-protein-coupled receptor 43 (GRP43) and G-protein-coupled receptor 41 (GRP41) activation, we also examined GPR41 and GRP43 in the colon of colitis mice and found that the colonic mRNA expression of GRP43 and GPR41 was significantly decreased after DSS challenge, and BLG treatment could effectively rescue these decreases (Figure 7C and D).
Figure 7 BLG increases serum GLP-1 levels and colonic Gcg, GPR41 and GRP43 mRNA expression in DSS-treated mice.(A) Gcg mRNA expression in colon tissue; (B) GLP-1 level in serum; (C) GPR41 mRNA expression in colon tissue; (D) GPR43 mRNA expression in colon tissue.Data are presented as mean ± SEM (n = 5–6).#p < 0.05 or ##p < 0.01 vs control (Con) group; *p < 0.05 vs DSS group.
Since BLG treatment could increase serum GLP-1 levels, colonic Gcg mRNA expression, and fecal SCFA levels in DSS-treated mice, we further examined acetate, propionate, and butyrate as well as from control (F-Con), DSS colitis (F-Con) -DSS) and BLG-treated colitis (F-BLG) mice on the release of GLP-1 from primary murine colonic epithelial cells.As shown in Figure 8A, primary mouse colonic epithelial cells treated with 2 mM acetic acid, propionic acid, and butyric acid, respectively, significantly stimulated GLP-1 release, consistent with previous studies.29,30 Likewise, all F-Con, F-DSS, and F-BLG (equivalent to 0.25 g of feces) greatly stimulated the release of GLP-1 from primary murine colonic epithelial cells.Notably, the amount of GLP-1 released by F-DSS-treated primary mouse colonic epithelial cells was much lower than that of F-Con and F-BLG-treated primary mouse colonic epithelial cells.(Figure 8B).These data suggest that BLG treatment significantly restored intestinal SCFA-derived GLP-1 production.
Figure 8 BLG-derived SCFA stimulates GLP-1 release from primary murine colonic epithelial cells.(A) Acetic acid, propionic acid, and butyric acid stimulated the release of GLP-1 from primary murine colonic epithelial cells; (B) fecal extracts F-Con, F-DSS and F-BLG stimulated primary murine colonic epithelial cells Amount of GLP-1 released.Aliquots of colonic epithelial cells were placed in glass-bottom petri dishes and treated with 2 mM acetic acid, propionic acid, butyric acid, and fecal extracts F-Con, F-DSS, and F-BLG (equivalent to 0.25 g feces), respectively. 2 hours at 37°C, 5% CO2, respectively.The amount of GLP-1 released from primary murine colonic epithelial cells was detected by ELISA.Data are presented as mean ± SEM (n = 3).#p < 0.05 or ##p < 0.01 vs. blank or F-Con; *p < 0.05 vs. F-DSS.
Abbreviations: Ace, acetic acid; Pro, propionic acid; however, butyric acid; F-Con, fecal extract from control mice; F-DSS, fecal extract from colitis mice; F-BLG, from BLG-treated colon Fecal extracts of inflammatory mice.
Listed by the World Health Organization as a refractory disease, UC is becoming a global danger; however, effective methods for predicting, preventing, and treating the disease are still limited.Therefore, there is an urgent need to explore and develop new safe and effective therapeutic strategies for UC.Traditional Chinese medicine preparations are a promising option because many traditional Chinese medicine preparations have been shown to be effective in the treatment of UC in the Chinese population over the centuries, and they are all biological organics and natural materials that are mostly harmless to humans and animals.31,32 This study aimed to seek a safe and effective traditional Chinese medicine preparation for the treatment of UC and to explore its mechanism of action.BLG is a well-known Chinese herbal formula used to treat the flu.8,33 Work in our laboratory and others has shown that indigo, a processed traditional Chinese medicine product from the same raw material as BLG, exhibits significant efficacy in the treatment of UC in humans and animals.4,34 However, the anti-colitis effects of BLG and its effects The mechanism is unclear.In the current study, our results demonstrate that BLG effectively attenuates DSS-induced colonic inflammation, which is associated with modulation of gut microbiota and restoration of gut-derived GLP-1 production.
It is well known that UC is characterized by relapsing periods with typical clinical features, such as weight loss, diarrhea, rectal bleeding, and extensive colonic mucosal damage.35 Thus, chronic relapsing colitis was administered by administering three cycles of 1.8% DSS for five days, followed by seven days of drinking water.As shown in Figure 1B, fluctuating weight loss and DAI scores indicated successful induction of chronic relapsing colitis.Mice in the group treated with BLG showed upshift recovery from day 8, which was significantly different from day 24.The same changes were also observed in the DAI score, suggesting an improvement in the clinical improvement of colitis.In terms of colon injury and inflammatory status, colon length, colon tissue damage, and gene expression and production of the proinflammatory cytokines TNF-α, IL-1β, and IL-6 in colon tissue were also greatly improved after BLG treatment.Collectively, these results clearly demonstrate that BLG is effective in the treatment of chronic relapsing colitis in mice.
How does BLG exert its pharmacological effects?Numerous previous studies have shown that the gut microbiota plays a key role in the pathogenesis of UC, and microbiome-based and microbiome-targeted therapies have emerged as a very attractive strategy for the treatment of UC.In the present study, we demonstrated that BLG treatment resulted in significant changes in gut microbiota composition, suggesting that the protective effect of BLG against DSS-induced colitis is related to modulation of gut microbiota.This observation is consistent with the notion that reprogramming the homeostasis of the gut microbiota is an important approach to understanding the efficacy of TCM preparations.36,37 Notably, Akkermansia is a Gram-negative and strictly anaerobic bacterium that lives in the mucus layer of the gut, which degrades mucins, produces propionic acid, stimulates goblet cell differentiation, and maintains the mucosa. function of barrier integrity.26 Multiple clinical and animal data suggest that Akkermansia is highly associated with healthy mucosa,38 and oral administration of Akkermansia spp. can significantly improve mucosal inflammation.39 Our current data suggest that the relative abundance of Akkermansia is significantly increased after BLG treatment.In addition, Prevotellaceae_UCG-001 is an SCFA-producing bacterium.27 Multiple studies showed that Prevotellaceae_UCG-001 was found in low relative abundance in the feces of animals with colitis.40,41 Our present data also show that BLG treatment can significantly increase the relative abundance of Prevotellaceae_UCG-001 in the colon of DSS-treated mice.In contrast, Oscillibacter is a mesophilic, strictly anaerobic bacterium.42 reported that the relative abundance of Oscillibacter was significantly increased in UC mice and was significantly positively correlated with IL-6 and IL-1β levels and pathological scores.43,44 Notably, BLG treatment significantly reduced the relative abundance of Oscillibacter in the feces of DSS-treated mice.Notably, these BLG-altered bacteria were the most SCFA-producing bacteria.Numerous previous studies have demonstrated the potential beneficial effects of SCFAs on colonic inflammation and protection of intestinal epithelial integrity.45,46 Our present data also observed that concentrations of SCFA acetate, propionate, and butyrate in DSS-treated feces were greatly increased in BLG-treated mice.Taken together, these findings clearly demonstrate that BLG treatment can effectively enhance DSS-induced SCFA-producing bacteria in mice with chronic relapsing colitis.
GLP-1 is an incretin mainly produced in the ileum and colon and plays an important role in delaying gastric emptying and lowering postprandial blood glucose.47 Evidence suggests that dipeptidyl peptidase (DPP)-4, a GLP-1 receptor agonist, and a GLP-1 nanomedicine can effectively alleviate intestinal inflammation in mice.48-51 As reported in previous studies, high SCFA concentrations were associated with plasma GLP-1 levels in humans and mice. 52 Our current data show that after BLG treatment, serum GLP-1 levels and Gcg mRNA expression was significantly increased.Likewise, GLP-1 secretion was significantly increased in colonic cultures following stimulation with fecal extracts from BLG-treated colitis mice compared to stimulation with fecal extracts from DSS-treated colitis mice.How do SCFAs affect the release of GLP-1?Gwen Tolhurst et al. reported that SCFA can stimulate GLP-1 secretion through GRP43 and GPR41.29 Our present data also show that BLG treatment significantly increases the mRNA expression of GRP43 and GPR41 in the colon of DSS-treated mice.These data suggest that BLG treatment can restore SCFA-promoted GLP-1 production by activating GRP43 and GPR41.
BLG is a long-term over-the-counter (OTC) drug in China. The maximum tolerated dose of BLG in Kunming mice is 80g/Kg, and no acute toxicity has been observed.53 Currently, the recommended dose of BLG (without sugar) in humans is 9-15 g/day (3 times a day).Our study showed that BLG at 1g/Kg ameliorated DSS-induced chronic relapsing colitis in mice.This dose is close to the BLG dose used clinically.Our study also found that its mechanism of action is mediated, at least in part, by alterations in the gut microbiota, specifically SCFA-producing bacteria, such as Akkermansia and Prevotellaceae_UCG-001, to restore gut-derived GLP-1 production.These findings suggest that BLG deserves further consideration as a potential therapeutic agent for clinical colitis treatment.However, the exact mechanism by which it modulates the gut microbiota remains to be confirmed by microbiota-deficient mice and fecal bacterial transplantation.
Ace, acetic acid; but, butyric acid; BLG, pandan; DSS, dextran sodium sulfate; DAI, disease activity index; DPP, dipeptidyl peptidase; FID, flame ionization detector; F-Con, control Fecal extracts of mice; F-DSS, fecal extracts of DSS colitis mice; F-BLG, fecal extracts of BLG-treated colitis mice; GLP-1, glucagon-like peptide-1; Gcg, glucagon; gas chromatography, gas chromatography; GRP43, G protein-coupled receptor 43; GRP41, G protein-coupled receptor 41; H&E, hematoxylin-eosin; HBSS, Hanks’ Balanced Salt Solution ; OTC, OTC; PCA, principal component analysis; PCoA, principal coordinate analysis; Pro, propionic acid; SASP, sulfasalazine; SCFA, short-chain fatty acids; Chinese medicine, traditional Chinese medicine; UC, ulcerative colitis.
All experimental protocols were approved by the Animal Ethics Committee of Peking University Shenzhen-Hong Kong University of Science and Technology Medical Center (Shenzhen, China) according to the Institutional Guidelines and Animal Regulations (ethics number A2020157).
All authors made significant contributions to conception and design, data acquisition, or data analysis and interpretation; participated in drafting the article or critically revising important intellectual content; agreed to submit the manuscript to the current journal; finally approved the version for publication; Responsible for all aspects of work.
This work was supported by the National Natural Science Foundation of China (81560676 and 81660479), the first-class project of Shenzhen University (86000000210), the Shenzhen Science and Technology Innovation Committee Fund (JCYJ20210324093810026), and the Guangdong Provincial Medical Science and Technology Research Fund (A2020157 and A2020272), Guizhou Medical University Pharmacy Guizhou Province Funded by Key Laboratory (YWZJ2020-01) and Peking University Shenzhen Hospital (JCYJ2018009).
1. Tang B, Zhu J, Zhang B, et al.Therapeutic potential of triptolide as an anti-inflammatory agent in dextran sodium sulfate-induced experimental colitis in mice.pre-immune.2020;11:592084.doi: 10.3389/fimmu.2020.592084
2. Kaplan GG.The global burden of IBD: from 2015 to 2025.Nat Rev Gastroenterol Hepatol.2015;12:720–727.doi: 10.1038/nrgastro.2015.150
3. Peng J, Zheng TT, Li Xue, et al.Plant-derived alkaloids: promising disease modifiers in inflammatory bowel disease.Prepharmacology.2019;10:351.doi:10.3389/fphar.2019.00351
4. Xiao Haiteng, Peng Jie, Wen B, et al.Indigo Naturalis inhibits colonic oxidative stress and Th1/Th17 responses in DSS-induced colitis in mice.Oxid Med Cell Longev.2019;2019:9480945.doi: 10.1155/2019/9480945
5. Chen M, Ding Y, Tong Z. Efficacy and safety of Sophora flavescens (Sophora flavescens) Chinese herbal medicine in the treatment of ulcerative colitis: clinical evidence and potential mechanisms.Prepharmacology.2020;11:603476.doi:10.3389/fphar.2020.603476
6. Cao Fang, Liu Jie, Sha Benxing, Pan HF.Natural products: experimentally effective drugs for the treatment of inflammatory bowel disease.Curr Pharmaceuticals.2019;25:4893–4913.doi: 10.2174/1381612825666191216154224
7. Zhang C, Jiang M, Lu A. Reflections on the adjuvant treatment of ulcerative colitis with traditional Chinese medicine.Clinical Rev Allergy Immunization.2013;44:274–283.doi: 10.1007/s12016-012-8328-9
8. Li Zhongteng, Li Li, Chen TT, et al.Efficacy and safety of Banlangen granules in the treatment of seasonal influenza: a study protocol for a randomized controlled trial.trial.2015;16:126.doi: 10.1186/s13063-015-0645-x